【病毒外文文獻(xiàn)】2004 A novel auto-cleavage assay for studying mutational effects on the active site of severe acute respiratory syndrome

《【病毒外文文獻(xiàn)】2004 A novel auto-cleavage assay for studying mutational effects on the active site of severe acute respiratory syndrome》由會(huì)員分享，可在線閱讀，更多相關(guān)《【病毒外文文獻(xiàn)】2004 A novel auto-cleavage assay for studying mutational effects on the active site of severe acute respiratory syndrome（5頁(yè)珍藏版）》請(qǐng)?jiān)谘b配圖網(wǎng)上搜索。

for acute August 2 a controversy about the coronavirus main proteases whether they all belong to the class of serine proteases because they have an additional domain at C termi nal In previous studies replacements of Cys with Ser in some of CoV main proteases produced inactive q This work was supported by a grant from the National Natural Science Foundation of China No 39930060 Corresponding author Fax 86 21 54921257 E mail address gjxu G J Xu Biochemical and Biophysical Research Commun 0006 291X see front matter C211 2004 Elsevier Inc All rights reserved Severe acute respiratory syndrome SARS broke out in southern China in 2003 and spread rapidly The path ogen of SARS was identified as a novel coronavirus CoV which belongs to Coronaviridae family 1 2 Coronavirus is a kind of positive stranded RNA virus characterized with an exceptionally large genome size up to 31 kb known to date SARS coronavirus SARS CoV replicase gene encodes two overlapping large proteins polyprotein 1a pp1a C24450 kDa and polyprotein 1ab pp1ab C24750 kDa which mediate the functions needed for transcription and replication of the virus pp1a and pp1ab are cleaved extensively by the specific proteases to release functional proteins and peptides One of the proteases encoded by the virus cleaves at least 11 conservative sites on pp1ab and plays a main role in proteolytic processing 3 It is named main protease M pro and also called 3C like protease 3CL pro Ascribing to its pivotal role in virus life circle SARS CoV 3CL pro has been suggested as a promising target for antiviral drug design 3 The structure of the 33 8 kDa protease of SARS CoV has three domains And the active site is predicted to in volve a catalytic dyad of His and Cys which is similar to those of main proteases in other coronaviruses There is Abstract The 3C like protease 3CL pro of severe acute respiratory syndrome SARS has been proposed as an attractive target for drug design His 41 and Cys 145 were essential for the active site as the principal catalytic residues In this study we mutated the two sites expressed four resulting mutants in Escherichia coli and characterized All mutants showed undetectable activity in trans cleavage assay In addition we introduced a 31 mer peptide containing an auto cleavage site to the N terminal of the proteases and found the peptide could be cleaved e ciently by 3CLsc itself but among the four mutants only the mutant Cys 145 fi Ser showed residual activity as detected by the auto cleavage assay The data supported the proposition unequivocally that SARS CoV 3CL pro was a member of serine proteases involving His 41 and Cys 145 residues at the active site The auto cleavage assay also provided a sensitive and reliable compensation to the traditional trans cleavage assay C211 2004 Elsevier Inc All rights reserved Keywords SARS 3CL protease Active site Auto cleavage assay N 31 tag A novel auto cleavage assay on the active site of severe coronavirus 3C like Yu Fei Shan a Shou Feng a Institute of Biochemistry and Cell biology Shanghai Institutes for Biological b College of Life Science Zhejiang University Received 19 Available online doi 10 1016 j bbrc 2004 09 088 studying mutational e ects respiratory syndrome protease q Li a Gen Jun Xu a b Sciences Chinese Academy of Sciences Shanghai 200031 China of Sciences Hangzhou 310018 China 2004 October 2004 ications 324 2004 579 583 BBRC enzymes as detected by trans cleavage assay 4 5 There were a few reports that Cys to Ser mutants showed residual activities either in a cis cleavage assay 6 or in a trans cleavage assay with an extremely high enzyme concentration 7 Because no enzyme was detected simultaneously in both trans and cis cleavage assays it is di cult to draw an unequivocal answer to the dis crepancy about the role of Ser In the present study we mutated the two residues at active site and detected the activities of mutants in both trans and a newly developed cis cleavage assays The re sults showed that Cys 145 fi Ser mutant had a residual activity only in the cis cleavage assay It suggested that our assay exploiting the auto processing capability of 3CL pro has advantages over the traditional peptide based activity detection system and can be employed in the substrate specificity study or other relevant The transformed cells were grown in 1 liter LB medium containing induced with 10 lM isopropyl 1 thio b D galactopyranoside for 6 h The cells were harvested by centrifugation 5000g for 10 min and suspended into 40 ml bu er A 20 mM Tris HCl pH 8 0 200 mM NaCl and 2 mM of 2 mercaptoethanol Lysis of the cells was achieved by ultrasonic and the suspension was centrifuged at 25 000g for 20 min Supernatant was applied to a bu er A equilibrated cobalt nitrilotriacetic acid column 4 ml beads The column was washed with 100 ml bu er A and then with bu er B 20 mM Tris HCl pH 8 0 200 mM NaCl and 10 mM imidazole until A 280 was less than 0 02 The target protein was eluted with 20 ml bu er C 20 mM Tris HCl pH 8 0 200 mM NaCl and 2 mM of 2 mercaptoethanol containing 200 mM imidazole The recovered protein was concentrated and loa ded on a gel filtration column Sephacryl S 200HR which was equilibrated with 250 ml bu er C The eluted enzyme was concentrated and stored at C020 C176C in bu er C containing 50 glycerol All mutants were performed in a similar way Peptide synthesis and trans cleavage assay A 16 mer peptide P439 TSITSAVLQfl SGFRKMA the arrow indicates cleavage site was synthesized by solid phase method The sequence was taken from the processing site of 3CL pro The synthetic peptide was purified through a GC TA 580 Y F Shan et al Biochemical and Biophysical Research Communications 324 2004 579 583 kanamycin 50 lg ml at 22 C176C until A 600 reached to 0 6 0 8 and then Table 1 Primers used for the amplification or mutagenesis of SARS CoV 3CL pro Primer Oligonucleotide sequence 5 0 fi 3 0 3CLsc ATGGCTAGCTCAATCACTTCTGCTGTTCTG CAGAGTGGTTTTAGGAAAATGGCA 3CLsm TATACCATGGGTTTTAGGAAAATGGCATT 3CLr GGTGCTCGAGTTGGAAGGTAACACCAGA GCATTGTC PH1 TACTGTCCTAGGGCTGTCATTTGCACA PH2 AATGACAGCCCTAGGACAGTATACTGTGTC PH3 TACTGTCCTAGGTGGGTCATTTGCACAGC PH4 AATGACCCACCTAGGACAGTATACTGTGTC PC1 AATGGATCCGCTGGTAGTGTTGGTTTTA PC2 ACTACCAGCGGATCCATTAAGGAAAG PC3 AATGGATCCAGTGGTAGTGTTGGTTT PC4 ACTACCACTGGATCCATTAAGGAAAG researches Materials and methods Construction of pET28a 3CLsm and pET28a 3CLsc The gene of SARS 3C like protease was a gift from Dr Li and was amplified by PCR using primers 3CLsm and 3CLr see Table 1 for the sequences of primers The PCR product was digested with NcoI and XhoI and inserted into NcoI XhoI cut plasmid pET 28a The plasmid pET28a 3CLsm encodes a 34 7 kDa 3CLsm protein flanked at a C terminal His 6 tag and with the first amino acid Ser replaced by Met The PCR product of a mutant using primers 3CLsc and 3CLr was digested with NheI and XhoI and inserted into NheI XhoI cut plasmid pET 28a The resulting plasmid pET28a 3CLsc encodes a protein 3CLsc con taining a 31 mer peptide MGSSHHHHHHSSGLVPRGSHMAS SITSAVLQ N 31 tag flanked at N terminal and a C terminal His 6 tag An auto cleavage site was located between N 31 tag and the N terminal of the protein This 31 mer sequence was also introduced to four mutants using the identical method as pET28a 3CLsc Expression and purification pET28a 3CLsm and pET28a 3CLsc were transformed respectively into Escherichia coli BL21 DE3 cells The oligonucleotide sequences indicating mutant codons are underlined C 18 reverse phase HPLC column and eluted with acetonitrile water linear gradient 0 80 containing 0 1 trifluoroacetic acid Identity and homogeneity were confirmed by mass spectrometry matrix as sisted laser desorption ionization time of flight MALDI TOF An 11 mer peptide P440 TSAVLP fl SGFRK was performed in a sim ilar way The cleavage assay was carried out in 40 ll bu er D 20 mM Tris HCl pH 7 35 containing 400 lM P439 200 mM NaCl 1 mM DTT and 1 mM EDTA and the reaction was initiated by adding 2 lg en zyme The reaction mixtures were incubated at 20 C176C for 0 16 h and then 40 ll of 2 trifluoroacetic acid was added to stop the reaction The products were characterized by reverse phase HPLC using a 5 65 linear gradient of acetonitrile water containing 0 1 trifluoro acetic acid The peaks were estimated by integrating the area and identified by mass spectroscopy Site directed mutagenesis Site directed mutagenesis was performed by a recombination PCR method The nucleotide sequences of primers are given in Table 1 Mutants were also constructed into pET 28a plasmid and expressed in BL21 DE3 cells The homogeneities of the purified mutant proteins were characterized by SDS PAGE Auto cleavage assay in vitro Two milligrams of purified SARS CoV 3CL protease of C 145 S mutant was incubated in 1 ml bu er D at 20 C176C for 0 36 h Aliquot of 50 ll was taken out every 9 h mixed with 50 llof2 SDS loading bu er and analyzed by SDS PAGE on 12 polyacrylamide gel Polarity Remark Forward Introduce N 31 tag C Forward Amplification Reverse Introduce His tag Forward His 41 to Ala Reverse Forward His 41 to Trp Reverse Forward Cys 145 to Ala Reverse Forward Cys 145 to Ser Reverse Results and discussion Expression purification and proteolytic activity of SARS CoV 3CL pro 3CLsm was successfully over expressed in E coli Most of the target protein was found in the soluble fraction of the cell lysate About 20 mg of 3CLsm pro tein was recovered from 1 liter LB media When 3CLsc was expressed in E coli the product had a sim ilar apparent molecular mass to that of 3CLsm see Fig 1 It indicated that an auto cleavage had oc curred during 3CLsc expression The activity of the recombinant 3CLsm was analyzed in peptide based trans cleavage assay in which 3CLsm 2 lg was incubated with 400 lM peptide P439 in 40 ll bu er D Analysis of the reaction products by re verse phase HPLC and mass spectrum revealed that P439 could be hydrolyzed As shown in Fig 2A more than half of the substrate was digested in 20 min when the incubation time was prolonged to 16 h shown in Fig 2B the activity of 3CL pro has a great pendence on enzyme concentration because the active of enzyme was suggested to be a dimer We had in d the concentration of the mutants up to 15 lM still no activity was detected Even higher enzyme ncentration could not be used because it will cause tion and precipitation at room temperature thin a few hours The great di erence in trans cleav assay between 3CLsm and the mutant enzymes ly supports a crucial catalytic function of His 41 d Cys 145 and is consistent with the published data other 3CL 3C proteases 8 Tibbles et al 6 reported that a mutant with the sub tution of the active site Cys with Ser in avian infec bronchitis virus 3CL pro produced an enzyme with residual activity in cis cleavage assay In contrast with finding although all 3CL proteases have conserva catalytic site characteristics no activity could be de ed for the corresponding Cys to Ser mutants of the se hepatitis virus and human coronavirus 2 Peptide P439 cleaved by 3CLsm Shown in A is the time of 400 lM P439 cleaved by 2 lg 3CLsm in 40 ll cleavage bu er in B are the cleavage activities of recombinant SARS CoV pro at di erent final enzyme concentrations implying strongly of specific activity with enzyme concentration Y F Shan et al Biochemical and Biophysical Research Mutation analysis of the catalytic site of SARS CoV 3CL pro It has been reported that His 41 and Cys 145 might play a key role in the catalytic process for coronavirus main proteases 3 We mutated these two residues of the en zyme and obtained four mutants H 41 A H 41 W C 145 A and C 145 S The mutants were characterized by SDS PAGE and the proteolytic activities were measured in trans cleavage assay But di erent from 3CLsm the activities of H 41 A H 41 W C 145 A and C 145 S were all un der the detection limitation in trans cleavage assay Fig 1 Bacterial expression and purification of recombinant SARS CoV 3CL pro Samples were analyzed by SDS PAGE on 12 polyacrylamide gel and stained with Coomassie brilliant blue M protein molecular mass markers kDa 1 total cell lysate from IPTG induced E coli BL21 pET28a 3CLsm 2 cell lysate pass through Cobalt a nity column pET28a 3CLsm 3 target 3CL pro eluted from Sephacryl S 200HR column 3CLsm and 4 pooled peak fractions from the Sephacryl S 200HR column 3CLsc even As de form crease but co aggrega wi age strong an of sti tious a their tive tect mou Fig course Shown 3CL dependence Communications 324 2004 579 583 581 strain 229E 3CL pro in trans cleavage assay 4 5 One explanation for this discrepancy is that cis cleavage as say has high sensitivity over the trans cleavage one 8 In our study Cys to Ser substitution also produced an enzyme with undetectable activity in trans cleavage as say So we decided to test the cleavage activity of this mutant in the novel cis cleavage assay Auto cleavage assay of SARS CoV 3CL pro mutants As mentioned above the 31 mer peptide N 31 tag introduced to the N terminal of 3CLsc could be cleaved e ciently so it might be applied in cis cleavage assay Therefore the N 31 tag was introduced to four mutants After expression three of the mutants H 41 A H 41 W and C 145 A yielded a higher apparent molecular mass than that of 3CLsc see Fig 3 It suggested that the three mutants did not show enzyme activity The results could serve as a negative control it excluded the possi bility that proteolytic process was caused by the expres sion system The cleavage should be performed by pro 145 though at a slow rate the corresponding cleavage site could be processed data not shown It implied that the novel auto cleavage assay is more sensitive In the study of Ziebuhr et al 5 the final concentra tion of enzyme was 1 lM which is the same in the study of Seybert et al 4 Comparing with our data those two 3CL proteases C 145 S probably also have residual activ ities in a cis cleavage assay Huang et al 7 reported the very low cleavage activity of Cys to Ser mutant of 3CL protease in a peptide based assay by using a synthetic p nitroanilide compound colorimetric substrate and three synthetic peptides S10 S06 and S09 in which the activity for substrate S09 was too low to be deter mined It should be noted that the enzyme concentration used in their assay was extremely high 76 9 lM about 2 6 mg ml Under such a high concentration of enzyme unexpected non specific side reactions could not be com pletely excluded In addition in case of the synthetic col orimetric substrate it might not involve the specificities contributed by downstream subsites And Shi et al 11 582 Y F Shan et al Biochemical and Biophysical Research Communications 324 2004 579 583 SARS CoV 3CL itself Interestingly for C S mu tant there were two bands visualized in SDS PAGE see Fig 3 lanes 4 and 6 The apparent molecular mass showed that the upper band retained the N 31 tag and the lower one did not It suggested that substitution Cys 145 with Ser in SARS CoV 3CL pro produced an enzyme with a very low activity despite the fact that the mutant did not show activity in trans cleavage assay To verify the fact we purified C 145 S with the N 31 tag and incubated 2 mg of the proteins in 1 ml bu er Dat20C176C for 0 36 h The reaction mixture was ana lyzed by SDS PAGE on a 12 polyacrylamide gel As shown in Fig 4 the band with N 31 tag disappeared gradually but the reaction was not completed even after Fig 3 Expression of SARS CoV 3CL pro mutants containing N 31 tag in E coli BL21 DE3 Total cell lysates of IPTG induced E coli samples were analyzed by SDS PAGE on 12 polyacrylamide gel and stained with Coomassie brilliant blue 1 lysate of mutant H 41 A 2 lysate of mutant H 41 W 3 lysate of mutant C 145 A 4 lysate of mutant C 145 S 5 purified 3CL pro 3CLsc as a control 6 purified 3CL pro C 145 S 7 total cell lysate of E coli 3CLsc without being induced and M protein molecular mass markers kDa 36 h incubation Under the same conditions 6 lg puri fied C 145 S protein was incubated with 400 lM peptide P439 in 40 ll bu er D at 20 C176C for trans cleavage pep tide assay still no protease activity could be detected The cleavage sites of 3CL pro commonly contain a dipeptide LQ sequence and the amino acid Gln is re ported as an absolutely conservative residue 9 Fan et al 10 reported a peptide TSAVLQ fl SGFRK could be cleaved by SARS CoV 3CL protease We syn thesized the peptide P440 TSAVLP fl SGFRK in which the Gln was replaced by Pro and performed trans cleavage assay at 10 lM 3CLsm No enzyme activ ity was detectable within 24 h We also introduced LP dipeptide to the N 31 tag at N terminal and tested auto cleavage assay It had been found that even Fig 4 Time course of SARS CoV 3CL pro C 145 S in auto cleavage assay The purified 3CL pro C 145 S was incubated in bu er D for 0 36 h at 20 C176C as described in Materials and methods the reaction products were analyzed by SDS PAGE on 12 polyacrylamide gel and stained with Coomassie brilliant blue 1 reacted for 0 h 2 reacted for 9 h 3 reacted for 18 h 4 reacted for 36 h 5 3CL sc protease and M protein molecular mass markers kDa reported the amino acids at C terminal to the cleavage site also have extensive interactions with the 3CL prote ase For these two reasons the explicit conclusion could not be drawn unequivocally The novel assay is simple sensitive and reliable and might be extended to other relevant protease studies In addition the results also support that the SARS CoV 3CL pro belongs to serine protease of the chymotrypsin family and clarified the discrepancy of previous researches References 1 K V Holmes L Enjuanes The SARS coronavirus a postge nomic era Science 300 2003 1377 1378 2 P A Rota M S Oberste S S Monroe W A Nix R Campagn oli J P Icenogle S Penaranda B Bankamp K Maher M H Chen S Tong A Tamin L Lowe M Frace J L DeRisi Q Chen D Wang D D Erdman T C Peret C Burns T G Ksiazek P E Rollin A Sanchez S Li ck B Holloway J Limor K McCaustland M Olsen Rasmussen R Fouchier S Gunther A D Osterhaus C Drosten M A Pallansch L J Anderson W J Bellini Characterization of a novel coronavirus associated with severe acute respiratory syndrome Science 300 2003 1394 1399 3 K Anand J Ziebuhr P Wadhwani J R Mesters R Hilgenfeld Coronavirus main proteinase 3CLpro structure basis for design of anti SARS drugs Science 300 2003 1763 1767 4 A Seybert J Ziebuhr S G Siddell Expression and character ization of a recombinant murine coronavirus 3C like proteinase J Gen Virol 78 1997 71 75 5 J Ziebuhr G Heusipp S G Siddell Biosynthesis purification and characterization of the human coronavirus 229E 3C like proteinase J Virol 71 1997 3992 3997 6 K W Tibbles I Brierley D Cavanagh T D Brown Character ization in vitro of an autocatalytic processing activity associated with the predicted 3C like proteinase domain of the coronavirus avian infectious bronchitis virus J Virol 70 1996 1923 1930 7 C Huang P Wei K Fan Y Liu L Lai 3C like Proteinase from SARS coronavirus catalyzes substrate hydrolysis by a general base mechanism Biochemistry 43 2004 4568 4574 8 J Ziebuhr E J Snijder A E Gorbalenya Virus encoded pro teinases and proteolytic processing in the Nidovirales J Gen Virol 81 2000 853 879 9 H Yang M Yang Y Ding Y Liu Z Lou Z Zhou L Sun L Mo S Ye H Pang G F Gao K Anand M Bartlam R Hilgenfeld Z Rao The crystal structures of severe acute respiratory syndrome virus main protease and its complex with an inhibitor Proc Natl Acad Sci USA 100 2003 13190 13195 10 K Fan P Wei Q Feng S Chen C Huang L Ma B Lai J Pei Y Liu J Chen L Lai Biosynthesis purification and substrate specificity of severe acute respiratory syndrome corona virus 3C like proteinase J Biol Chem 279 2004 1637 1642 11 J Shi Z Wei J Song Dissection study on the severe acute respiratory syndrome 3C like protease reveals the critical role of the extra domain in dimerization of the enzyme defining the extra domain as a new target for design of highly specific protease inhibitors J Biol Chem 279 2004 24765 24773 Y F Shan et al Biochemical and Biophysical Research