【病毒外文文獻(xiàn)】2011 Evidence that TMPRSS2 Activates the Severe Acute Respiratory Syndrome Coronavirus Spike Protein for Membrane Fusion

《【病毒外文文獻(xiàn)】2011 Evidence that TMPRSS2 Activates the Severe Acute Respiratory Syndrome Coronavirus Spike Protein for Membrane Fusion》由會員分享，可在線閱讀，更多相關(guān)《【病毒外文文獻(xiàn)】2011 Evidence that TMPRSS2 Activates the Severe Acute Respiratory Syndrome Coronavirus Spike Protein for Membrane Fusion（13頁珍藏版）》請在裝配圖網(wǎng)上搜索。

JOURNAL OF VIROLOGY May 2011 p 4122 4134 Vol 85 No 9 0022 538X 11 12 00 doi 10 1128 JVI 02232 10 Copyright 2011 American Society for Microbiology All Rights Reserved Evidence that TMPRSS2 Activates the Severe Acute Respiratory Syndrome Coronavirus Spike Protein for Membrane Fusion and Reduces Viral Control by the Humoral Immune Response H17188 Ilona Glowacka 1 Stephanie Bertram 1 Marcel A Mu ller 2 Paul Allen 3 Elizabeth Soilleux 3 Susanne Pfefferle 4 Imke Steffen 1 Theodros Solomon Tsegaye 1 Yuxian He 5 Kerstin Gnirss 1 Daniela Niemeyer 2 Heike Schneider 6 Christian Drosten 2 and Stefan Po hlmann 1 7 Institute of Virology Hannover Medical School 30625 Hannover Germany 1 Institute of Virology University of Bonn Medical Centre 53127 Bonn Germany 2 Department of Cellular Pathology John Radcliffe Hospital Oxford OX3 9DU England 3 Bernhard Nocht Institute for Tropical Medicine 20359 Hamburg Germany 4 Institute of Pathogen Biology Chinese Academy of Medical Sciences and Peking Union Medical College Beijing 1007302 China 5 Institute for Physiological Chemistry Hannover Medical School 30625 Hannover Germany 6 and German Primate Center Kellnerweg 4 37077 Go ttingen Germany 7 Received 25 October 2010 Accepted 27 January 2011 The spike S protein of the severe acute respiratory syndrome coronavirus SARS CoV can be proteolyti cally activated by cathepsins B and L upon viral uptake into target cell endosomes In contrast it is largely unknown whether host cell proteases located in the secretory pathway of infected cells and or on the surface of target cells can cleave SARS S We along with others could previously show that the type II transmembrane protease TMPRSS2 activates the influenza virus hemagglutinin and the human metapneumovirus F protein by cleavage Here we assessed whether SARS S is proteolytically processed by TMPRSS2 Western blot analysis revealed that SARS S was cleaved into several fragments upon coexpression of TMPRSS2 cis cleavage and upon contact between SARS S expressing cells and TMPRSS2 positive cells trans cleavage cis cleavage resulted in release of SARS S fragments into the cellular supernatant and in inhibition of antibody mediated neutralization most likely because SARS S fragments function as antibody decoys trans cleavage activated SARS S on effector cells for fusion with target cells and allowed efficient SARS S driven viral entry into targets treated with a lysosomotropic agent or a cathepsin inhibitor Finally ACE2 the cellular receptor for SARS CoV and TMPRSS2 were found to be coexpressed by type II pneumocytes which represent important viral target cells suggesting that SARS S is cleaved by TMPRSS2 in the lung of SARS CoV infected individuals In summary we show that TMPRSS2 might promote viral spread and pathogenesis by diminishing viral recog nition by neutralizing antibodies and by activating SARS S for cell cell and virus cell fusion The severe acute respiratory syndrome coronavirus SARS CoV is the causative agent of the lung disease SARS which claimed H11011800 lives in 2002 to 2003 49 SARS CoV related viruses were identified in bats and palm civets 19 33 37 and it is believed that human contact with the latter animals pos sibly within animal markets in southern China was responsible for the introduction of SARS CoV into the human population The viral spike S protein mediates infectious entry into target cells by engaging the carboxypeptidase angiotensin converting enzyme 2 ACE2 36 60 and several changes in the spike sequence of SARS CoV from humans relative to SARS CoV from palm civets reflect the adaptation to efficient usage of the human receptor 35 38 39 most likely a prerequisite for high viral pathogenicity Thus the SARS S protein is an important determinant of viral cell and species tropism 27 and explo ration of its functions is essential to devise effective strategies for prevention and therapy The SARS S protein comprises 1 255 amino acids and har bors 23 consensus sequences for N linked glycosylation The S protein is synthesized in the secretory pathway of infected cells and S protein trimers are incorporated into the viral envelope derived from the endoplasmic reticulum Golgi intermediate compartment ERGIC and the plasma membrane of the host cell 34 The S protein exhibits the domain organization of class I fusion proteins it contains an N terminal surface unit S1 which engages the receptor and a C terminal transmem brane unit S2 which contains the membrane fusion machin ery 27 A prominent feature of many class I fusion proteins is the requirement for proteolytic activation by host cell enzymes 14 A seminal study by Simmons and colleagues showed that proteolytic activation of SARS S is mediated by cathepsins in target cells most importantly by cathepsin L 53 In contrast the efficiency and biological relevance of SARS S processing by proteases in infected cells is at present incompletely under stood The type II transmembrane serine protease TMPRSS2 has recently been shown to proteolytically activate the fusion pro Corresponding author Mailing address Infection Biology Unit German Primate Center Kellnerweg 4 37077 Go ttingen Germany Phone 49 551 3851 150 Fax 49 551 3851 184 E mail s poehlmann dpz eu I G and S B contributed equally to this work H17188 Published ahead of print on 16 February 2011 4122 on March 20 2015 by guest http jvi asm org Downloaded from teins of human influenza viruses 6 8 and TMPRSS2 was found to activate human metapneumovirus 51 In addition the related protein TMPRSS11a has been demonstrated to cleave SARS S and to moderately increase viral infectivity 30 Here we investigated whether SARS S is a substrate of TMPRSS2 and if cleavage modulates biological properties of SARS S bearing viruses We show that SARS S is proteolyti cally processed by TMPRSS2 Cleavage resulted in shedding of SARS S fragments and interference with antibody mediated neutralization or in activation of SARS S for cell cell and virus cell fusion depending on the presence of TMPRSS2 on SARS S expressing cells or on adjacent susceptible cells These observations in conjunction with our finding that ACE2 and TMPRSS2 are coexpressed in type II pneumocytes important viral target cells suggest that TMPRSS2 might impact SARS CoV spread by at least two independent mechanisms MATERIALS AND METHODS Plasmid construction and in vitro mutagenesis Expression plasmids pCAGGS SARS S encoding the spike protein of SARS CoV strain Frankfurt and pcDNA3 hACE2 encoding human ACE2 hACE2 have been described previously 25 26 The plasmids encoding human TMPRSS2 and TMPRSS4 and mouse matriptase 3 have also been described previously 29 51 57 Cell culture Vero E6 and 293T cells were propagated in Dulbecco s modified Eagle s medium DMEM supplemented with 10 fetal bovine serum FBS penicillin and streptomycin and were grown in a humidified atmosphere con taining 5 CO 2 293T cells stably expressing ACE2 293T hACE2 18 were generated by transfection of plasmid pcDNA3 1zeo hACE2 25 into 293T cells followed by selection of resistant cells with zeocin Invitrogen at 50 H9262g ml Homogenous surface expression of ACE2 on stably transfected cells was con firmed by fluorescence activated cell sorting FACS analysis Production of lentiviral pseudotypes and infection experiments For genera tion of lentiviral pseudotypes calcium phosphate transfections were performed as described previously 26 54 In brief 293T cells were transiently cotrans fected with pNL4 3 E R Luc 11 and expression plasmids for SARS S or the G protein of vesicular stomatitis virus VSV G For some experiments human TMPRSS2 or TMPRSS4 or mouse matriptase 3 was coexpressed during produc tion of pseudotypes The culture medium was replaced at 16 h and harvested at 48 h posttransfection The supernatants were passed through 0 45 H9262m pore size filters aliquoted and stored at H1100280 C For normalization of different virus stocks capsid protein p24 contents were determined using a commercially available kit Murex Wiesbaden Germany Alternatively virus stocks were normalized for infectivity which was assessed by infecting 293T hACE2 cells with different dilutions of pseudotypes followed by determination of luciferase activities in cell lysates by employing a commercially available kit Promega Madison WI For infection experiments 293T hACE2 cells were incubated with equal volumes of p24 or infectivity normalized pseudotypes for 16 h Thereafter medium was changed and luciferase activities in cell lysates were determined at 72 h postinfection For inhibition experiments cells were prein cubated with the cathepsin inhibitor MDL 28170 Calbiochem Nottingham United Kingdom for 30 min or viruses were preincubated with antiserum obtained by immunization of mice with an S1 protein fragment comprising amino acids 12 to 327 62 for 60 min before the addition to target cells Culture supernatants were removed at 16 h postinfection and replaced by fresh medium without inhibitor For some inhibition studies the pseudotypes were first pelleted through a sucrose cushion by ultracentrifugation for2hat25 000 rpm and 4 C to separate particles from SARS S fragments not associated with virions and then incubated with antiserum in the presence and absence of shed SARS S protein Production of VLPs For production of virus like particles VLPs 293T cells were cotransfected with the HIV 1 Gag p55 encoding plasmid p96ZM651gag opt 16 SARS S expression plasmid and expression plasmids for proteases or empty vector The supernatants containing the VLPs were collected at 48 h posttransfection and concentrated by ultrafiltration using VivaSpin centrifugal concentrators Sartorius Aubagne Cedex France Alternatively or additionally the VLPs were concentrated by ultracentrifugation through a 20 sucrose cush ionfor2hat25 000 rpm and 4 C Subsequently the concentrated supernatants were treated with phosphate buffered saline PBS or trypsin followed by addi tion of soybean trypsin inhibitor Sigma Deisenhofen Germany Production of shed SARS S protein For production of shed SARS S protein 293T cells were cotransfected with plasmids encoding SARS S and TMPRSS2 or empty vector At 48 h posttransfection the supernatants were harvested and concentrated using VivaSpin columns Sartorius Aubagne Cedex France fol lowed by ultracentrifugation through a 20 sucrose cushion for2hat25 000 rpm and 4 C to remove vesicles harboring SARS S protein The SARS S protein remaining in the supernatants of ultracentrifuged material was then analyzed by immunoblotting to confirm size and purity Detection of SARS S by immunoblotting For Western blot analysis lysed VLP preparations were separated by SDS PAGE and transferred onto nitrocellulose membranes SARS S protein was detected by staining with rabbit serum specific for the S1 subunit generated by immunization with a peptide comprising SARS S amino acids 19 to 48 24 or the S2 subunit Imgenex San Diego CA For a loading control the stripped membranes were incubated with an anti HIV p24 antibody PNGase F digest of SARS S For the analysis of SARS S glycosylation VLPs were concentrated via VivaSpin columns samples taken for immunoblotting and additionally ultracentrifuged through a 20 sucrose cushion at 25 000 rpm for2hat4 C The resulting pellets were harvested with TNE Tris HCl 0 15 M NaCl and 10 mM EDTA buffer and digested by peptide N glycosidase F PNGase F New England BioLabs Frankfurt Germany The digested samples were then analyzed by immunoblotting as described above Immunohistochemistry Tissue samples obtained with full ethical approval from the National Research and Ethics Service Oxfordshire Research and Ethics Committee A reference 04 Q1604 21 were stained with hematoxylin and eosin using standard techniques and were immunostained for ACE2 affinity purified goat polyclonal serum R Leica Micro systems Newcastle Ltd Newcastle United Kingdom was substituted for the primary antibody Stained sections were photographed with a Nikon DS FI1 camera with a Nikon DS L2 control unit Nikon United Kingdom Limited Kingston upon Thames United Kingdom and an Olympus BX40 microscope Olympus UK Limited Watford United Kingdom Quantitative reverse transcription PCR RT PCR analysis of TMPRSS2 mRNA expression For detection of Tmprss2 transcripts by real time PCR an ABI 7500 FAST real time PCR system Applied Biosystems Carlsbad was used The PCR mixtures contained 0 5 H9262l of cDNA Clontech Saint Germain en Laye France in a total volume of 10 H9262l Specific amplification was ensured with TaqMan gene expression assays catalog number 4331182 Applied Biosystems which were used according to the manufacturer s recommendations The follow ing specific assays were used Hs00237175 m1 TMPRSS2 and Hs99999908 m1 H9252 glucuronidase GUSB The average cycle threshold value C T for each individual assay was calculated from triplicate measurements by means of the instrument s software in the auto C T mode 7500 FAST System Software version 1 3 0 Average C T values calculated for TMPRSS2 were normalized by subtrac tion from the C T values obtained for GUSB housekeeping reference Tem plate free cDNA reactions were analyzed in parallel using both TaqMan assays no specific signal was detected in any of these experiments trans cleavage of SARS S by TMPRSS2 In order to determine if SARS S on the cell surface can be cleaved by TMPRSS2 on neighboring cells trans cleav age 293T cells were transfected with plasmids encoding SARS S TMPRSS2 or TMPRSS4 or empty vector At 24 h posttransfection the cells were resuspended in fresh FCS free DMEM and cells expressing SARS S were mixed with cells expressing empty vector or protease at a ratio of 1 1 7 The mixed cells were seeded again in new cell culture flasks for further incubation for 30 h at 37 C Subsequently the supernatants were harvested centrifuged for 5 min at 4 000 rpm passed through a 0 45 H9262m pore size filter and concentrated by ultrafiltra tion using VivaSpin centrifugal concentrators Sartorius Aubagne Cedex France Additionally the concentrated supernatants were loaded on a 20 sucrose cushion and ultracentrifuged for2hat25 000 rpm and 4 C After ultracentrifugation the supernatants were harvested and the pellet was resus pended in TNE buffer To analyze SARS S cleavage lysates of transfected cells and samples of supernatants taken during the different processing steps were VOL 85 2011 TMPRSS2 ACTIVATES SARS CORONAVIRUS SPIKE PROTEIN 4123 on March 20 2015 by guest http jvi asm org Downloaded from analyzed for the presence of SARS S by Western blotting employing sera specific for the S1 and S2 subunits of SARS S SARS S driven cell cell fusion For analysis of SARS S driven cell cell fusion 293T effector cells seeded in six well plates at 1 2 H11003 10 5 cells well were CaPO 4 transfected with either an empty pCAGGS plasmid or pCAGGS encoding SARS S in combination with plasmid pGAL4 VP16 which encodes the herpes simplex virus VP16 transactivator fused to the DNA binding domain of the Saccharomy ces cerevisiae transcription factor GAL4 In parallel 293T target cells were seeded in 48 well plates at 0 8 H11003 10 5 cells well and transfected with pcDNA3 or the hACE2 expression vector or with a protease expressing vector together with plasmid pGal5 luc which encodes the luciferase reporter gene under the control of a promoter containing five GAL4 binding sites The day after transfection effector cells were diluted in fresh medium and added to the target cells For trypsin treatment medium from target cells was completely removed and effec tor cells in medium supplemented with 100 ng ml trypsin Sigma Deisenhofen Germany or PBS were added After a 6 h incubation fresh medium was added to the trypsin and PBS treated samples Cell cell fusion was quantified by de termination of luciferase activities in cell lysates 48 h after cocultivation using a commercially available kit Promega Madison WI TMPRSS2 dependent syncytium formation Vero E6 cells seeded in a six well plate at 6 H11003 10 5 cells well were Lipofectamine transfected with TMPRSS2 or TMPRSS4 expression plasmid or control transfected with empty vector After 24 h cells were infected with SARS CoV strain Frankfurt 1 at a multiplicity of infection MOI of 0 1 for1hat37 C Subsequently the cells were washed and fresh culture medium was added At 29 h postinfection the cells were fixed with paraformaldehyde 8 and analyzed by microscopy Pictures were taken with a Zeiss phase contrast inverted microscope Televal 31 at a 200 fold magnifica tion TMPRSS2 dependent cathepsin independent cellular entry of SARS CoV 293T hACE2 cells seeded in a six well plate at 6 H11003 10 5 cells well were trans fected in triplicates with expression plasmids encoding TMPRSS2 or TMPRSS4 or control transfected with empty vector After 24 h transfected cells were incubated with either DMEM containing the cathepsin inhibitor MDL 28170 stock solution prepared in dimethyl sulfoxide DMSO at a final concentration of 9 H9262M or DMEM containing the same volume of DMSO as negative control for 60 min at 37 C Subsequently the cells were infected with SARS CoV Frankfurt strain 1 at an MOI of 0 1 for 30 min at 4 C washed twice with PBS and incubated with fresh DMEM At 5 h postinfection the cells were washed with PBS and lysed and total RNA was extracted by an RNeasy Protect Mini kit Qiagen Hilden Germany SARS CoV entry was determined by quantitative RT PCR specific for the subgenomic mRNA sgmRNA of the N transcript For this the oligonucleotides SsgN F AACCTCGATCTCTTGTAGATCTGT SsgN R TGAATCTGTGGGTCCACCAA and SsgN P FAM CTCTAAACG AACAAATTAAAATGTCTGATAATGG BHQ1 where FAM is 6 carboxy fluorescein and BHQ1 is Black Hole quencher 1 were used with a SuperScript III One Step RT PCR kit Invitrogen The total reaction mixture volume was 12 5 H9262l quarter reaction and the mixture contained 30 nmol of MgSO 4 5 pmol of each oligonucleotide and 2 5 pmol of the probe The C T values measured in single experiments performed in triplicates were normalized by subtracting the respective C T value for the TATA box binding protein housekeeping reference gene 50 For clarity values were subtracted by a fixed number 20 A C T difference of 3 correlated approximately with a 10 fold increase as determined by a dilution series of both targets RESULTS The pulmonary protease TMPRSS2 cleaves SARS S at mul tiple sites Recent studies showed that TMPRSS2 TMPRSS4 and other type II transmembrane serine proteases TTSPs can activate human influenza viruses 6 8 10 Since the lung is also the major target organ of SARS CoV we asked whether TMPRSS2 and TMPRSS4 can cleave the SARS S protein We included murine matriptase 3 in these experiments since we previously found that this protease was unable to process in fluenza virus hemagglutinin HA and would thus serve as a negative control 8 Employing an S2 specific antibody West ern blot analysis of virus like particles VLPs released from transiently transfected cells revealed a prominent 160 to 170 kDa band representing full length SARS S and upon trypsin treatment a 90 kDa band representing S2 Fig 1 top panel in agreement with published data 3 67 When TMPRSS2 and S protein were coexpressed the largest band observed was approximately 150 kDa instead of the 160 kDa expected for full length SARS S with additional bands of 45 55 and 85 kDa Fig 1 top panel In contrast coexpression of TMPRSS4 or matriptase 3 did not facilitate SARS S cleavage Efficient proteolytic processing of SARS S by TMPRSS2 was FIG 1 Proteolytic processing of SARS S by TMPRSS2 Top VLPs were produced by coexpression of HIV p55 Gag and SARS S in the absence and presence of coexpressed human TMPRSS2 TMPRSS4 or murine matriptase 3 treated with trypsin or PBS and analyzed for S protein and HIV p55 Gag content as indicated using a serum specific for the S2 subunit of SARS S B The experiment was carried out as described for panel A However an S1 specific antiserum was used for SARS S protein detection 4124 GLOWACKA ET AL J VIROL on M